ID: 963281632_963281642

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 963281632 963281642
Species Human (GRCh38) Human (GRCh38)
Location 3:143390139-143390161 3:143390192-143390214
Sequence CCAAGGTTGCCCATATGCCATTT TGGATTTCATGAAACTCTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 107} {0: 1, 1: 0, 2: 2, 3: 14, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!