ID: 963642259_963642262

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 963642259 963642262
Species Human (GRCh38) Human (GRCh38)
Location 3:147875429-147875451 3:147875459-147875481
Sequence CCTGTCTCTTGTCAGACCATTGG TAGTAACTGTGTCTGACTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!