ID: 963716858_963716861

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 963716858 963716861
Species Human (GRCh38) Human (GRCh38)
Location 3:148812669-148812691 3:148812697-148812719
Sequence CCTTGTGGAACTGTAAGTCCAAT CTCTTTCTGTTCCCAGTTTCTGG
Strand - +
Off-target summary {0: 1298, 1: 2452, 2: 4016, 3: 6253, 4: 6129} {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!