ID: 963746942_963746946

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 963746942 963746946
Species Human (GRCh38) Human (GRCh38)
Location 3:149134121-149134143 3:149134138-149134160
Sequence CCTAATGACAACATTAGCAGGGG CAGGGGCCTGCACTGGGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93} {0: 1, 1: 0, 2: 2, 3: 42, 4: 515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!