ID: 963799107_963799122

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 963799107 963799122
Species Human (GRCh38) Human (GRCh38)
Location 3:149658884-149658906 3:149658923-149658945
Sequence CCGCCCTCCGGGGAGCCTGGAGC CAGGTGGCTGGAAGTAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 255} {0: 1, 1: 0, 2: 5, 3: 66, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!