|
Left Crispr |
Right Crispr |
Crispr ID |
963831226 |
963831228 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:150011760-150011782
|
3:150011801-150011823
|
Sequence |
CCTAAAATAAAAGTTAAAAGTTT |
AAGAAGAAGAAGAAGAAGGCCGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 13, 2: 135, 3: 623, 4: 2787} |
{0: 13, 1: 55, 2: 313, 3: 900, 4: 3924} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|