ID: 963831226_963831228

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 963831226 963831228
Species Human (GRCh38) Human (GRCh38)
Location 3:150011760-150011782 3:150011801-150011823
Sequence CCTAAAATAAAAGTTAAAAGTTT AAGAAGAAGAAGAAGAAGGCCGG
Strand - +
Off-target summary {0: 2, 1: 13, 2: 135, 3: 623, 4: 2787} {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!