ID: 963834876_963834880

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 963834876 963834880
Species Human (GRCh38) Human (GRCh38)
Location 3:150048150-150048172 3:150048176-150048198
Sequence CCCTGGGAAGGAGGTAAGGAGCA TAAGAAAAATACCAAGTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 311} {0: 1, 1: 1, 2: 5, 3: 84, 4: 840}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!