ID: 963882525_963882532

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 963882525 963882532
Species Human (GRCh38) Human (GRCh38)
Location 3:150545444-150545466 3:150545486-150545508
Sequence CCAACTGGATCATTACCAAGACC CTGTGAGTACAAATTAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 111} {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!