ID: 963894788_963894791

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 963894788 963894791
Species Human (GRCh38) Human (GRCh38)
Location 3:150673747-150673769 3:150673770-150673792
Sequence CCCAGCTAACACTTTGTGGAGAC GGAGTTTTGCCATGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 298} {0: 311, 1: 4738, 2: 23032, 3: 70855, 4: 198074}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!