ID: 963943819_963943823

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 963943819 963943823
Species Human (GRCh38) Human (GRCh38)
Location 3:151123174-151123196 3:151123222-151123244
Sequence CCCTAAACATTCTGCATATCAAG AAGATTTTAAAATCAAGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 282} {0: 1, 1: 0, 2: 6, 3: 55, 4: 666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!