ID: 964041732_964041744

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 964041732 964041744
Species Human (GRCh38) Human (GRCh38)
Location 3:152269142-152269164 3:152269191-152269213
Sequence CCGGCGGGTCTGCCCGTGGCTGA CGGCCGCGGTTCTCCCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94} {0: 1, 1: 0, 2: 1, 3: 14, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!