ID: 964417161_964417166

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 964417161 964417166
Species Human (GRCh38) Human (GRCh38)
Location 3:156459494-156459516 3:156459509-156459531
Sequence CCCTTTGGACACTACCAAGCTGG CAAGCTGGACATTTATATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102} {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!