ID: 964451505_964451511

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 964451505 964451511
Species Human (GRCh38) Human (GRCh38)
Location 3:156817045-156817067 3:156817062-156817084
Sequence CCGGCGGGCTGCAGGCACGCAGG CGCAGGCGGCGCGGCGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!