ID: 964473962_964473966

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 964473962 964473966
Species Human (GRCh38) Human (GRCh38)
Location 3:157082267-157082289 3:157082314-157082336
Sequence CCCCTTGTGTTTTGAAGAGTACA TCAGAAACCAGCTAGAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 171} {0: 1, 1: 0, 2: 5, 3: 22, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!