ID: 964487992_964487994

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 964487992 964487994
Species Human (GRCh38) Human (GRCh38)
Location 3:157205776-157205798 3:157205789-157205811
Sequence CCTCTGACTGGCTCTCACATGTG CTCACATGTGCTCCAAAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!