ID: 964501925_964501927

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 964501925 964501927
Species Human (GRCh38) Human (GRCh38)
Location 3:157357469-157357491 3:157357516-157357538
Sequence CCTTTGTCCATCTGCATTGTAAG AGAGTCTTGCTCTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 152} {0: 6551, 1: 32159, 2: 84434, 3: 153956, 4: 178272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!