ID: 964505584_964505588

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 964505584 964505588
Species Human (GRCh38) Human (GRCh38)
Location 3:157395424-157395446 3:157395463-157395485
Sequence CCTTTGTGAGTGGACGTCCATGT AACCTCCTTCTCTGACACCATGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 199, 3: 281, 4: 243} {0: 1, 1: 0, 2: 25, 3: 272, 4: 503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!