ID: 964506414_964506422

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 964506414 964506422
Species Human (GRCh38) Human (GRCh38)
Location 3:157404920-157404942 3:157404966-157404988
Sequence CCAATGCCCAGTTGTCCTTTCTG GTTAGGCTCATGGCTAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 320} {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!