ID: 964529609_964529614

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 964529609 964529614
Species Human (GRCh38) Human (GRCh38)
Location 3:157652935-157652957 3:157652983-157653005
Sequence CCCACACACTCATAGAGAGACAT CTCCTGCATATACACACATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 317} {0: 1, 1: 0, 2: 1, 3: 19, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!