ID: 964569945_964569955

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 964569945 964569955
Species Human (GRCh38) Human (GRCh38)
Location 3:158099632-158099654 3:158099653-158099675
Sequence CCCAGGCCCCTTCAGGGATTCCC CCATGAGGACAGAAGGGACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200} {0: 1, 1: 0, 2: 4, 3: 24, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!