ID: 964584424_964584430

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 964584424 964584430
Species Human (GRCh38) Human (GRCh38)
Location 3:158280935-158280957 3:158280974-158280996
Sequence CCGCGCCTGGCCCAAAGTGATTC ACTGGCTGTTTTGCAACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 177, 4: 1230} {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!