ID: 964651763_964651768

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 964651763 964651768
Species Human (GRCh38) Human (GRCh38)
Location 3:159019414-159019436 3:159019430-159019452
Sequence CCTGTGTAACCACCATCCAGATC CCAGATCAAGGAACTTCAGAAGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 55, 3: 202, 4: 553} {0: 1, 1: 0, 2: 0, 3: 18, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!