ID: 964670064_964670065

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 964670064 964670065
Species Human (GRCh38) Human (GRCh38)
Location 3:159215143-159215165 3:159215156-159215178
Sequence CCTGAGTGTGTTTATGCTGGGCT ATGCTGGGCTTGATGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144} {0: 1, 1: 0, 2: 7, 3: 22, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!