ID: 964679243_964679249

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 964679243 964679249
Species Human (GRCh38) Human (GRCh38)
Location 3:159318905-159318927 3:159318944-159318966
Sequence CCCAGTAACAGGCCATGAGCTGT AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 4, 1: 176, 2: 198, 3: 158, 4: 256} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!