ID: 964721450_964721463

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 964721450 964721463
Species Human (GRCh38) Human (GRCh38)
Location 3:159770720-159770742 3:159770767-159770789
Sequence CCCTTTTCCCATTGCTCTATTCC CCTCCCTTCAGGTGGCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 461} {0: 1, 1: 0, 2: 1, 3: 28, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!