ID: 964721453_964721463

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 964721453 964721463
Species Human (GRCh38) Human (GRCh38)
Location 3:159770728-159770750 3:159770767-159770789
Sequence CCATTGCTCTATTCCATCTGCAT CCTCCCTTCAGGTGGCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 313} {0: 1, 1: 0, 2: 1, 3: 28, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!