ID: 964748190_964748195

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 964748190 964748195
Species Human (GRCh38) Human (GRCh38)
Location 3:160031180-160031202 3:160031223-160031245
Sequence CCTACACCAATGGCTAATTGAGA ATCTTCAGCAAAAGGAACTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113} {0: 1, 1: 0, 2: 1, 3: 50, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!