ID: 964785101_964785104

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 964785101 964785104
Species Human (GRCh38) Human (GRCh38)
Location 3:160387670-160387692 3:160387705-160387727
Sequence CCAATGGAGAAGTCAAAGAGAAA CAGTAAGTCTGGAGTCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 410} {0: 1, 1: 1, 2: 1, 3: 10, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!