ID: 964802249_964802257

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 964802249 964802257
Species Human (GRCh38) Human (GRCh38)
Location 3:160568869-160568891 3:160568920-160568942
Sequence CCAATGCCAAGCTCTCCAAGCTG GGAGCTGATGAAAGTCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 36, 4: 196} {0: 1, 1: 22, 2: 16, 3: 19, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!