ID: 964846033_964846039

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 964846033 964846039
Species Human (GRCh38) Human (GRCh38)
Location 3:161045184-161045206 3:161045220-161045242
Sequence CCCCCCACTGTCAACATTAGACA CAAAGTTAACAAGGATATCCAGG
Strand - +
Off-target summary {0: 11, 1: 5, 2: 18, 3: 21, 4: 156} {0: 35, 1: 2059, 2: 3016, 3: 4969, 4: 2359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!