ID: 965377582_965377593

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 965377582 965377593
Species Human (GRCh38) Human (GRCh38)
Location 3:167944680-167944702 3:167944732-167944754
Sequence CCAACAAGAAACCATAGAAGTCA AGTTTGAAAATAGACCCAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!