ID: 965511767_965511775

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 965511767 965511775
Species Human (GRCh38) Human (GRCh38)
Location 3:169575571-169575593 3:169575616-169575638
Sequence CCGCCTTGTCCTGCTTTTATCTT CTTAGAAGGCTTTTGGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 57, 4: 642} {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!