ID: 965511772_965511779

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 965511772 965511779
Species Human (GRCh38) Human (GRCh38)
Location 3:169575603-169575625 3:169575651-169575673
Sequence CCTCCACACTGGACTTAGAAGGC ATTCTGGGCTGCATCCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 116} {0: 1, 1: 0, 2: 1, 3: 18, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!