ID: 965517223_965517227

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 965517223 965517227
Species Human (GRCh38) Human (GRCh38)
Location 3:169634500-169634522 3:169634520-169634542
Sequence CCAAGGCTTGTTGGTAAGGGTGA TGAAGAGGGGCAAATAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106} {0: 1, 1: 0, 2: 5, 3: 33, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!