ID: 965517223_965517230

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 965517223 965517230
Species Human (GRCh38) Human (GRCh38)
Location 3:169634500-169634522 3:169634529-169634551
Sequence CCAAGGCTTGTTGGTAAGGGTGA GCAAATAGCAGAGGGCAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106} {0: 1, 1: 0, 2: 1, 3: 45, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!