ID: 965598335_965598337

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 965598335 965598337
Species Human (GRCh38) Human (GRCh38)
Location 3:170430102-170430124 3:170430128-170430150
Sequence CCCACTTTTGAGGTTTAGGGCTG AAGTAGATTGTGTATTGCTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 69, 4: 739} {0: 1, 1: 0, 2: 1, 3: 19, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!