ID: 965605656_965605667

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 965605656 965605667
Species Human (GRCh38) Human (GRCh38)
Location 3:170495653-170495675 3:170495695-170495717
Sequence CCTGCTGAGCCCTGTTAACCTGG GGCCATGCACACCCAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 11, 3: 24, 4: 187} {0: 2, 1: 4, 2: 7, 3: 28, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!