ID: 965622380_965622387

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 965622380 965622387
Species Human (GRCh38) Human (GRCh38)
Location 3:170654607-170654629 3:170654635-170654657
Sequence CCTCCTGAGTGGGCCAGCATCAT CCTCTTCCACCCCAGGAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 104} {0: 1, 1: 0, 2: 2, 3: 24, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!