ID: 965634725_965634735

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 965634725 965634735
Species Human (GRCh38) Human (GRCh38)
Location 3:170769533-170769555 3:170769552-170769574
Sequence CCTCACTCCCAGAAGGAGGCAGG CAGGTCTAGGGGAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 438} {0: 1, 1: 0, 2: 9, 3: 67, 4: 663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!