ID: 965681132_965681136

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 965681132 965681136
Species Human (GRCh38) Human (GRCh38)
Location 3:171252858-171252880 3:171252886-171252908
Sequence CCATGTAAGACAGGAAAAATGGG CAGAAAATTTAAATGGAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 274} {0: 1, 1: 0, 2: 2, 3: 34, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!