ID: 965770186_965770192

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 965770186 965770192
Species Human (GRCh38) Human (GRCh38)
Location 3:172173812-172173834 3:172173842-172173864
Sequence CCTGTCTGGGGGAGGGGTGGGGC GGGAAGCCTCCCGATGTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 124, 4: 1184} {0: 1, 1: 0, 2: 1, 3: 16, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!