ID: 965774001_965774012

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965774001 965774012
Species Human (GRCh38) Human (GRCh38)
Location 3:172209683-172209705 3:172209729-172209751
Sequence CCATAGGCTTCAGGCCCTCCCTG GGACCTGCCCCTTCCTGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 23, 2: 171, 3: 319, 4: 552} {0: 5, 1: 13, 2: 97, 3: 253, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!