ID: 965774125_965774137

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 965774125 965774137
Species Human (GRCh38) Human (GRCh38)
Location 3:172210191-172210213 3:172210226-172210248
Sequence CCGCCAGCTCCACGAAGCCGCCC TGCAGTTGGCATCTTTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 318} {0: 2, 1: 4, 2: 13, 3: 54, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!