ID: 965874344_965874354

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 965874344 965874354
Species Human (GRCh38) Human (GRCh38)
Location 3:173299263-173299285 3:173299309-173299331
Sequence CCTCCTGCCGGGAGGTGGCACTT CTGTGGGGAGGAGCAGGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 108, 2: 284, 3: 386, 4: 537} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!