ID: 965910788_965910790

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 965910788 965910790
Species Human (GRCh38) Human (GRCh38)
Location 3:173772788-173772810 3:173772814-173772836
Sequence CCATCCTTTTTCTGTATTCACTG GTATTATTTTGTTCTTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 475} {0: 1, 1: 0, 2: 2, 3: 58, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!