ID: 965910795_965910801

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 965910795 965910801
Species Human (GRCh38) Human (GRCh38)
Location 3:173772853-173772875 3:173772896-173772918
Sequence CCTAATTGCAGCTTCCTCTCCTT CACCTCGCTTTTGCATCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 317} {0: 1, 1: 0, 2: 1, 3: 6, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!