ID: 965985260_965985266

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 965985260 965985266
Species Human (GRCh38) Human (GRCh38)
Location 3:174745456-174745478 3:174745501-174745523
Sequence CCAACCAAAAAGTCTGGGGCCAG CTAGAGGTACAAAGAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 224} {0: 63, 1: 2364, 2: 4236, 3: 6087, 4: 2897}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!