ID: 966044548_966044553

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 966044548 966044553
Species Human (GRCh38) Human (GRCh38)
Location 3:175532677-175532699 3:175532708-175532730
Sequence CCATTACGGTGGCTACACCCACC TACATATGAGTGTCGCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 37, 3: 82, 4: 221} {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!