ID: 966046395_966046402

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 966046395 966046402
Species Human (GRCh38) Human (GRCh38)
Location 3:175556024-175556046 3:175556077-175556099
Sequence CCAGAGAACAGCAGACTCCAGAG CTCACTTCAGCATTTATTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 353} {0: 1, 1: 0, 2: 2, 3: 39, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!