ID: 966194289_966194294

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 966194289 966194294
Species Human (GRCh38) Human (GRCh38)
Location 3:177298036-177298058 3:177298060-177298082
Sequence CCTTTCCCGTGGTGCCATGGGAC CACACTTGGCCCCCTCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 112} {0: 1, 1: 1, 2: 4, 3: 20, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!